Slate, December 22, 2011

Link

Here is one of the scariest things you’ll ever read:

atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaat

These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries.

Continue reading “Strain Game”

Nature, December 21, 2011

Link

In the summer of 2010, on a tiny island off the coast of Maine, I saw the future of books. I had been invited to teach a writing course at Shoals Marine Laboratory on Appledore Island, a beautiful bulge of rock covered in scrub and herring-gull nests. During a break at the beach with my family, my wife finished reading her book with typical supersonic speed. She craved another, so decided to experiment with her new iPhone.

She tapped the screen. In seconds, an e-book had streamed invisibly through the air into her hand. Swiping her thumb like a windshield wiper, she soon finished it. She tapped the screen for another. Out of the ether, another e-book appeared.

Continue reading “Technology: Rise of the e-book”

In this week’s issue of Nature, I write about the revolution that technology is bringing to the world of books. It’s a subject that’s been on my mind a lot recently. I’ve been experimenting with e-books myself, and I’ve been giving some talks about them (I’ll be helping to lead a discussion at Science Online 2012 in January).

My essay is accompanied by this funny picture. The guy looks a lot like me, but, strictly speaking, it should be my wife sitting atop the pile of books, with seagulls for company:

Continue reading “The Rise of the E-book: My new essay for Nature”

Eric Michael Johnson, an historian of science, is also the writer behind an excellent blog, “The Primate Diaries.” The other day he gave me a call to talk about science writing. He put together a two-part Q&A that he published today (part one and part two) that ranges from the science writing in Moby Dick to the microscopic virtues of Twitter. I was particularly flattered to get a portrait done by Nathaniel Gold. Check it out!

Originally published December 20, 2011. Copyright 2011 Carl Zimmer.

Recently I blogged about a new strain of potentially dangerous flu that evolved during experiments in the Netherlands and Wisconsin. There I tried to counter the misconception that scientists had intentionally concocted this particular strain. Because these new flus actually evolved pretty quickly in laboratories, we now know we should take seriously the possibility that this transformation may happen in the outside world someday.

But there’s a second issue at play with this new virus: should the world get to see its genome?

Continue reading “Should the new flu stay secret? Or does secrecy kill?”