Playboy, January 2, 2012

Link

On a hay-mown crest, dozens of people are crouching in the dark. The Earth has turned away from the sun, and the sky has flowed down a color chart, from light gray to orange to bluish-black. A sliver of a waxing moon has appeared briefly and then slipped below the western horizon, leaving the sky to blinking airplanes rising from La Guardia fifty miles to the south, to satellites gliding in low orbit, to Jupiter and its herd of moons and to the great river of the Milky Way beyond.

Continue reading “King of the Cosmos”

In 2011, the Loom reached its eighth birthday. Thanks to everyone who’s paid a visit or become a loyal reader in that time. With the year coming to a close, I spent a little time this week perusing the Loom’s archive, reflecting on the things that obsessed me during 2011.

More than many years, this one reminded me just how huge science is. Even if you limited yourself to the most important stories of this past year, there was just too much to keep up with. (Here’s Discover’s top 100 picks.) As a science writer, my focus is biology, but that didn’t ease my year-long case of head-spinning. The anchors that kept me from spinning away completely were the very small and the very complicated.

Continue reading “2011: A Letter from the Loom”

Eckard Wimmer makes viruses from scratch. When he first made a polio virus out of raw ingredients in 2002, some congressmen drafted a resolution to condemn him. Today, he’s making viruses that act like vaccines.

Wimmer was one of several virologists I called over the past couple days to talk about the controversy swirling around altered bird flu viruses that have the scientific community deeply worried. Their reactions are all over the board, from those who think the research shouldn’t have even been done in the first place to others who want the research published in full and replicated many times over. My report is over at Slate. It’s a debate that gets to the heart of the scientific process in the twenty-first century. Check it out.

Originally published December 22, 2011. Copyright 2011 Carl Zimmer.

I’ve written a few times  here about the battle over a virus called XMRV, and its supposed link to chronic fatigue system. I just wanted to point this morning to a few articles by some fine writers about the latest twist: the paper that first claimed a link has been completely retracted.

Ivan Oransky in Reuters

Jon Cohen in Science

Ewen Callaway in Nature

[Image: Wikipedia]

Originally published December 22, 2011. Copyright 2011 Carl Zimmer.

Slate, December 22, 2011

Link

Here is one of the scariest things you’ll ever read:

atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaat

These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries.

Continue reading “Strain Game”