Author: admin

Study Finds Virus to Be Fast Learner on Infecting

Posted on by admin

The New York Times, January 26, 2012

Link

Viruses regularly evolve new ways of making people sick, but scientists usually do not become aware of these new strategies until years or centuries after they have evolved. In a new study published on Thursday in the journal Science, however, a team of scientists at Michigan State University describes how viruses evolved a new way of infecting cells in little more than two weeks.

The report is being published in the midst of a controversy over a deadly bird flu virus that researchers manipulated to spread from mammal to mammal. Some critics have questioned whether such a change could have happened on its own. The new research suggests that new traits based on multiple mutations can indeed occur with frightening speed.

Continue reading “Study Finds Virus to Be Fast Learner on Infecting” →

Yeast Experiment Hints at a Faster Evolution From Single Cells

Posted on by admin

The New York Times, January 16, 2012

Link

Our ancestors were single-celled microbes for about three billion years before they evolved bodies. But in a laboratory at the University of Minnesota, brewer’s yeast cells can evolve primitive bodies in about two weeks.

The transition to multicellular life has long intrigued evolutionary biologists. The cells in our bodies have evolved to cooperate with exquisite precision. The human body has more than 200 types of cells, each dedicated to a different job. And a vast majority of the 100 trillion cells in our bodies sacrifice their own long-term legacy: Only eggs and sperm have a chance to survive our own death.

Continue reading “Yeast Experiment Hints at a Faster Evolution From Single Cells” →

Can A Scientist Define “Life”?

Posted on by admin

Txchnologist, January 10, 2012

Link

In November 2011, NASA launched its biggest, most ambitious mission to Mars. The $2.5 billion Mars Science Lab spacecraft will arrive in orbit around the Red Planet this August, releasing a lander that will use rockets to control a slow descent into the atmosphere. Equipped with a “sky crane” (NASA’s official, and very cool, term), the lander will gently lower the one-ton Curosity rover on the surface of Mars. Curiosity, which weighs five times more than any previous Martian rover, will perform an unprecedented battery of tests for three months as it scoops up soil from the floor of the 96-mile-wide Gale Crater. Its mission, NASA says, will be to “assess whether Mars ever was, or is still today, an environment able to support microbial life.”

Continue reading “Can A Scientist Define “Life”?” →

King of the Cosmos

Posted on by admin

Playboy, January 2, 2012

Link

On a hay-mown crest, dozens of people are crouching in the dark. The Earth has turned away from the sun, and the sky has flowed down a color chart, from light gray to orange to bluish-black. A sliver of a waxing moon has appeared briefly and then slipped below the western horizon, leaving the sky to blinking airplanes rising from La Guardia fifty miles to the south, to satellites gliding in low orbit, to Jupiter and its herd of moons and to the great river of the Milky Way beyond.

Continue reading “King of the Cosmos” →

Strain Game

Posted on by admin

Slate, December 22, 2011

Link

Here is one of the scariest things you’ll ever read:

atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaat

These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries.

Continue reading “Strain Game” →